pBBL-AP1-Luciferase

 

Cat # BB-V0055 (10 µg)

Description: pBBL-AP1-Luciferase plasmid expresses luciferase in mammalian cell driven by the AP1 (Activator protein 1) transcription factors. The plasmid is amplified in E. coli.

The sequence of the binding site is ACGTTGACTCAGTCTGACTCATGCTGACTCAACGT which is cloned at SalI-BamHI site. Ampicillin is selective marker.

Storage: -20°C.

Address

EN-35, First floor, Salt Lake, Sector - V, Kolkata - 700091, West Bengal, INDIA

Call Us

+91 9836508080

Scroll to Top