Catalogue No. Quantity/Specifications
Cat # BB-V0055 50 µg


Technology

pBBL-AP1- Luciferase

PDF DOWNLOAD

pBBL-AP1- Luciferase

Description: pBBL-AP1-Luciferase plasmid express luciferase in mammalian cell driven by the AP1 (Activator protein 1) transcription factors. The plasmid is amplified in E. coli.

The sequence of the binding site is ACGTTGACTCAGTCTGACTCATGCTGACTCAACGT which is cloned at SalI-BamHI site.
Ampicilin is selective marker.
Storage:    -20°C