Catalogue No. Quantity/Specifications
Cat # BB-V0065 50 µg


Technology

pBBL-NFAT- Luciferase

PDF DOWNLOAD

pBBL-NFAT- Luciferase

Description: pBBL- NFAT Luciferase plasmid express luciferase in mammalian cell driven by the NF-kB family of dimeric transcription factors. The plasmid is amplified in E. coli.

The sequence of the binding site is ACGTTGGAAAATTTGCTTGGAAAATTTACGT which is cloned at SalI-BamHI site.
Ampicilin is selective marker.
Storage:    -20°C