pBBL-TK-Luciferase Cat # BB-V0075 (10mg) Description: The pBBLTK Luciferase (firefly) Reporter Vectors are intended for use as an internal control reporters in combination with any experimental reporter vector to co-transfect mammalian cells. The pBBL-TK Vectors contain promoters to express luciferase in co-transfected mammalian cells. The TK(thymidine kinase) sequence which is cloned at SalI-BamHI site. …
pBBL-Stat-Luciferase Partial sequence of pBBL-Stat-Luciferase: Download PDF Address EN-35, First floor, Salt Lake, Sector – V, Kolkata – 700091, West Bengal, INDIA Call Us +91 9836508080 Email Us [email protected]
pBBL-NFAT-Luciferase Partial sequence of pBBL-NFAT-Luciferase in pUC18 backbone Download PDF Address EN-35, First floor, Salt Lake, Sector – V, Kolkata – 700091, West Bengal, INDIA Call Us +91 9836508080 Email Us [email protected]
pBBL-kBLuc Cat#BB-V0035 (10µg) Description: pBBL-kBLuc plasmid expresses luciferase in mammalian cell driven by the NF-B family of dimeric transcription factors. The plasmid is ampicillin resistant and amplified in E. coli. The sequence of the binding site is GGGACTTTCC GCTG GGGACTTTCC which is cloned at SalI-BamHI site. Download PDF Address EN-35, First floor, Salt Lake, …
pBBL eGFP Assay Vector Cat # BB-V0085 (10µg) The multiple cloning region of the pBBL-eGFP Assay vector. This vector is modified on the backbone of pGL4.72 vector. Download PDF Address EN-35, First floor, Salt Lake, Sector – V, Kolkata – 700091, West Bengal, INDIA Call Us +91 9836508080 Email Us [email protected]
pBBL-CMV-Luciferase Cat # BB-V0070 (10µg) Description: The pBBL-CMV Luciferase (firefly) Reporter Vectors are intended for use as an internal control reporter in combination with any experimental reporter vector to co-transfect mammalian cells. The pBBL-CMV Vectors contain promoters or enhancers or both to express luciferase in co-transfected mammalian cells. Download PDF Address EN-35, First floor, Salt Lake, …
pBBL-AP1-Luciferase Cat # BB-V0055 (10 µg) Description: pBBL-AP1-Luciferase plasmid expresses luciferase in mammalian cell driven by the AP1 (Activator protein 1) transcription factors. The plasmid is amplified in E. coli. The sequence of the binding site is ACGTTGACTCAGTCTGACTCATGCTGACTCAACGT which is cloned at SalI-BamHI site. Ampicillin is selective marker. Storage: -20°C. Download PDF Address EN-35, First floor, …
