bbioladmin

Protein Molecular Weight Ladder

Protein Molecular Weight Ladder Cat #BB-P10 (500µl) Cat #BB-P11 (500µl×2) This molecular weight ladder is ready to load on SDS-PAGE. It gives distinct bands upon staining with Coomassie Brilliant Blue. Loading: 5µl/well (Mini gel) and 10µl/well (Large gel) Storage buffer: 25mM Tris-HCl (pH 7.4, 1 mM EDTA and 40 mM DTT,    2% SDS, 50% glycerol.       Recommended

Protein Molecular Weight Ladder Read More »

Activated Agarose Beads

Activated Agarose Beads Cat # BB-AG001A (5ml) Cat # BB- AG001B (10ml) Cat # BB- AG001C (25ml) Bead Diameter: Spherical, 50 -150μm Cross-Linked: Yes Agarose %: 6% Binding Capacity: 8-10 mg of protein/ml beads under optimum conditions. Volume %: 50% (v/v) aqueous suspension with 20% Ethanol Application: The aldehyde activated agarose beads allow the covalent binding of

Activated Agarose Beads Read More »

pBBL- Myc

pBBL- Myc Cat# BB-V0040 (10µg) Description: pBBL-Myc is a shuttle vector used to express proteins in mammalian cells as Myc-fusion proteins. The plasmid is amplified in E.coli. Kanamycin and neomycin are the selective markers for the vector. Store at -20°C. Download PDF Address EN-35, First floor, Salt Lake, Sector – V, Kolkata – 700091, West

pBBL- Myc Read More »

pBBL- His

pBBL- His   Cat# BB-V0040 (10µg) Description: pBBL-His is a shuttle vector used to express proteins in mammalian cells as His-fusion proteins. The plasmid is amplified in E.coli. Kanamycin and neomycin are the selective marker for the vector. Store at -20°C. Download PDF Address EN-35, First floor, Salt Lake, Sector – V, Kolkata – 700091,

pBBL- His Read More »

pBBL- HA

pBBL- HA Cat# BB-V0030 (10µg) Description: pBBL-HA is a shuttle vector used to express proteins in mammalian cells as HA-fusion proteins. The plasmid is amplified in E.coli. Kanamycin and neomycin are the selective markers for the vector. Store at -20°C. Download PDF Address EN-35, First floor, Salt Lake, Sector – V, Kolkata – 700091, West

pBBL- HA Read More »

pBBL- FLAG

pBBL- FLAG   Cat# BB-V0031 (10µg) Cat.# BB-PAGH01C (1000µl)   Description: pBBL-FLAG is a shuttle vector used to express proteins in mammalian cells as FLAG-fusion proteins. The plasmid is amplified in E.coli. Kanamycin and neomycin are the selective markers for the vector. Store at -20°C. Download PDF Address EN-35, First floor, Salt Lake, Sector – V,

pBBL- FLAG Read More »

pBBL-AP1-Luciferase

pBBL-AP1-Luciferase   Cat # BB-V0055 (10 µg) Description: pBBL-AP1-Luciferase plasmid expresses luciferase in mammalian cell driven by the AP1 (Activator protein 1) transcription factors. The plasmid is amplified in E. coli. The sequence of the binding site is ACGTTGACTCAGTCTGACTCATGCTGACTCAACGT which is cloned at SalI-BamHI site. Ampicillin is selective marker. Storage: -20°C. Download PDF Address EN-35, First floor,

pBBL-AP1-Luciferase Read More »

Anti-GST Antibody

Anti-GST Antibody Cat# BB-AB0020 100µl (100µg) Cat# BB-AB0020S 25µl (25µg)   Clonality: Polyclonal Host: Rabbit Immunogen: Recombinant GST expressed in E. coli. Purification: Affinity chromatography. Specificity: Detects GST-fused recombinant proteins expressed in eukaryotic and prokaryotic cells. Application: Western blotting, ELISA. Recommended Dilution: Western Blotting: 1:2000 ELISA: 1:10000            Storage buffer: Tris Buffer

Anti-GST Antibody Read More »

Scroll to Top