ABO Blood Grouping Teaching Kit Cat# BB-ITK070 (100 reactions) Aim: To determine the blood group and Rh factor of an individual. Principle: The most well-known and medically important blood types are ABO group. ABO groups were discovered in 1900 and 1901 at the University of Vienna by Karl Landsteiner in the process of trying to […]
Protein Molecular Weight Ladder Cat #BB-P10 (500µl) Cat #BB-P11 (500µl×2) This molecular weight ladder is ready to load on SDS-PAGE. It gives distinct bands upon staining with Coomassie Brilliant Blue. Loading: 5µl/well (Mini gel) and 10µl/well (Large gel) Storage buffer: 25mM Tris-HCl (pH 7.4, 1 mM EDTA and 40 mM DTT, 2% SDS, 50% glycerol. Recommended
Activated Agarose Beads Cat # BB-AG001A (5ml) Cat # BB- AG001B (10ml) Cat # BB- AG001C (25ml) Bead Diameter: Spherical, 50 -150μm Cross-Linked: Yes Agarose %: 6% Binding Capacity: 8-10 mg of protein/ml beads under optimum conditions. Volume %: 50% (v/v) aqueous suspension with 20% Ethanol Application: The aldehyde activated agarose beads allow the covalent binding of
BBL Gel Extraction & PCR Clean Up Combo Kit Cat# BB-GPK50 (50 preps) Introduction: BBL-Gel Extraction& PCR Clean Up Combo Kit is a column based nucleic acid purification kit where the column has silica membrane which is capable of purifying DNA fragments easily from TAE or TBE agarose gel (both normal and low melting
pBBL- Myc Cat# BB-V0040 (10µg) Description: pBBL-Myc is a shuttle vector used to express proteins in mammalian cells as Myc-fusion proteins. The plasmid is amplified in E.coli. Kanamycin and neomycin are the selective markers for the vector. Store at -20°C. Download PDF Address EN-35, First floor, Salt Lake, Sector – V, Kolkata – 700091, West
pBBL- His Cat# BB-V0040 (10µg) Description: pBBL-His is a shuttle vector used to express proteins in mammalian cells as His-fusion proteins. The plasmid is amplified in E.coli. Kanamycin and neomycin are the selective marker for the vector. Store at -20°C. Download PDF Address EN-35, First floor, Salt Lake, Sector – V, Kolkata – 700091,
pBBL- HA Cat# BB-V0030 (10µg) Description: pBBL-HA is a shuttle vector used to express proteins in mammalian cells as HA-fusion proteins. The plasmid is amplified in E.coli. Kanamycin and neomycin are the selective markers for the vector. Store at -20°C. Download PDF Address EN-35, First floor, Salt Lake, Sector – V, Kolkata – 700091, West
pBBL- FLAG Cat# BB-V0031 (10µg) Cat.# BB-PAGH01C (1000µl) Description: pBBL-FLAG is a shuttle vector used to express proteins in mammalian cells as FLAG-fusion proteins. The plasmid is amplified in E.coli. Kanamycin and neomycin are the selective markers for the vector. Store at -20°C. Download PDF Address EN-35, First floor, Salt Lake, Sector – V,
pBBL-AP1-Luciferase Cat # BB-V0055 (10 µg) Description: pBBL-AP1-Luciferase plasmid expresses luciferase in mammalian cell driven by the AP1 (Activator protein 1) transcription factors. The plasmid is amplified in E. coli. The sequence of the binding site is ACGTTGACTCAGTCTGACTCATGCTGACTCAACGT which is cloned at SalI-BamHI site. Ampicillin is selective marker. Storage: -20°C. Download PDF Address EN-35, First floor,
Anti-GST Antibody Cat# BB-AB0020 100µl (100µg) Cat# BB-AB0020S 25µl (25µg) Clonality: Polyclonal Host: Rabbit Immunogen: Recombinant GST expressed in E. coli. Purification: Affinity chromatography. Specificity: Detects GST-fused recombinant proteins expressed in eukaryotic and prokaryotic cells. Application: Western blotting, ELISA. Recommended Dilution: Western Blotting: 1:2000 ELISA: 1:10000 Storage buffer: Tris Buffer
